During germination the seed reserve carbohydrates are degraded by -amylase
activity. The identification of mRNA is a very important tool for definition of -amylase synthesis
kinetics. This study aimed to adapt a PT-PCR methodology for -identification of amylase mRNA
in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34
maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform
extraction method, with some modifications. The cDNA was obtained from the total RNA, using
random primers. The alfa-amylase gene PCR amplification was carried out with cDNA, primers
(sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC);
gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC
water. The amplification cycles were 94oC/4 minutes, 34 cycles of 94oC /1 minute, 42oC/1 minute
and 72oC/1,5 minutes, and finally 72oC/5 minutes. The RT-PCR product visualization in agarose
gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both
the cultivars, without unspecific bands. The RT-PCR is an eficient method for α-amylase expression
studies during germination and can be used as a tool for quantitative and qualitative research
about α-amylase sinthesis kinetics.